Skip to main content

pW228-lenti-sg1-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
(Plasmid #189944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189944 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pW212 (Addgene #170810)
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #1
  • gRNA/shRNA sequence
    TAAAGCCACCACAGCGTCGC
  • Species
    Synthetic; B. coriaceae
  • Insert Size (bp)
    1209

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

3rd generation lentiviral backbone.

Please visit https://doi.org/10.1101/2022.02.28.482127 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pW228-lenti-sg1-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR was a gift from Kenneth Yamada (Addgene plasmid # 189944 ; http://n2t.net/addgene:189944 ; RRID:Addgene_189944)
  • For your References section:

    Efficient Gene Knockout in Salivary Gland Epithelial Explant Cultures. Sekiguchi R, Mehlferber MM, Matsumoto K, Wang S. J Dent Res. 2023 Feb;102(2):197-206. doi: 10.1177/00220345221128201. Epub 2022 Nov 10. 10.1177/00220345221128201 PubMed 36366748