pW318-lenti-sg2-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR
(Plasmid
#189948)
-
PurposeLentiviral vector to co-express a mouse Itga9 spsgRNA (sg2-Itga9) with NLS-mScarlet-I
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepW212 (Addgene #170810)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-mScarlet-I-P2A-BlastR; Itga9 spsgRNA #2
-
gRNA/shRNA sequenceTGGGCGGCCCGGCTGCGGCG
-
SpeciesSynthetic; B. coriaceae
-
Insert Size (bp)1209
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
3rd generation lentiviral backbone.
Please visit https://doi.org/10.1101/2022.02.28.482127 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pW318-lenti-sg2-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR was a gift from Kenneth Yamada (Addgene plasmid # 189948 ; http://n2t.net/addgene:189948 ; RRID:Addgene_189948) -
For your References section:
Efficient Gene Knockout in Salivary Gland Epithelial Explant Cultures. Sekiguchi R, Mehlferber MM, Matsumoto K, Wang S. J Dent Res. 2023 Feb;102(2):197-206. doi: 10.1177/00220345221128201. Epub 2022 Nov 10. 10.1177/00220345221128201 PubMed 36366748