pENTR-mCherry.OVA(323-339)
(Plasmid
#190006)
-
PurposeGateway entry vector for the expression of mCherry and OVA323-339 peptide fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR-CBX
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 6776
- Total vector size (bp) 5350
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry.OVA(323-339)
-
Alt namemCherry, OTII peptide
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)847
-
Tag
/ Fusion Protein
- OVA(323-339) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-mCherry.OVA(323-339) was a gift from Siyuan Zhang (Addgene plasmid # 190006 ; http://n2t.net/addgene:190006 ; RRID:Addgene_190006)