CMV:eGFP-p2A-HA-GPR151
(Plasmid
#190133)
-
Purposeexpresses eGFP-p2A-HA-GPR151 (wild-type variant) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV:eGFP-p2A-HA-β2Ar-uTEV1Δ(220-242)
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 8837
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP-p2A-HA-GPR151
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1260
-
GenBank IDAB083592.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- eGFP (N terminal on insert)
- p2A (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV:eGFP-p2A-HA-GPR151 was a gift from Joshua Knowles (Addgene plasmid # 190133 ; http://n2t.net/addgene:190133 ; RRID:Addgene_190133) -
For your References section:
G protein-coupled receptor 151 regulates glucose metabolism and hepatic gluconeogenesis. Bielczyk-Maczynska E, Zhao M, Zushin PH, Schnurr TM, Kim HJ, Li J, Nallagatla P, Sangwung P, Park CY, Cornn C, Stahl A, Svensson KJ, Knowles JW. Nat Commun. 2022 Dec 1;13(1):7408. doi: 10.1038/s41467-022-35069-9. 10.1038/s41467-022-35069-9 PubMed 36456565