Cas9_P2A_T4pol
(Plasmid
#190146)
-
PurposeExpresses SpCas9 and T4pol
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330A
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9_P2A_T4pol
-
SpeciesSynthetic
-
Insert Size (bp)7068
-
MutationCodon Optimized for mammalian cells
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- 3′ sequencing primer T3 (GCAATTAACCCTCACTAAAGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTakashi Yamamoto
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Supplemental GenBank file: pX330A-1x2 (Plasmid #58766) . Please visit https://doi.org/10.1101/2022.12.05.518807 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9_P2A_T4pol was a gift from Timothy Lu (Addgene plasmid # 190146 ; http://n2t.net/addgene:190146 ; RRID:Addgene_190146) -
For your References section:
Frame Editors for Precise, Template-Free Frameshifting. Nakade S, Nakamae K, Tang T-C, Yu D, Sakuma T, Yamamoto T, Lu TK. bioRxiv 2022.12.05.518807 10.1101/2022.12.05.518807