pAurora
(Plasmid
#190158)
-
Purpose(Empty Backbone) Regulates bacterial expression of target gene in blue-light-activated manner. Based on Nakamurella multipartita PAL.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- His6 tag (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 3′ sequencing primer tttgatgcctggcagttccc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAurora was a gift from Andreas Moeglich (Addgene plasmid # 190158 ; http://n2t.net/addgene:190158 ; RRID:Addgene_190158) -
For your References section:
Light-Dependent Control of Bacterial Expression at the mRNA Level. Ranzani AT, Wehrmann M, Kaiser J, Juraschitz M, Weber AM, Pietruschka G, Gerken U, Mayer G, Moglich A. ACS Synth Biol. 2022 Oct 21;11(10):3482-3492. doi: 10.1021/acssynbio.2c00365. Epub 2022 Sep 21. 10.1021/acssynbio.2c00365 PubMed 36129831