pcDNA3.1_rSERT_C109A_Y107C
(Plasmid
#190174)
-
PurposeFor expression of a SERT mutant in mammalian cells and measuring accessibility in the SERT extracellular pathway
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7423
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC6A4 Serotonin Transporter
-
Alt nameSERT
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1959
-
Mutationchanged Cys109 to alanine, changed tyr107 to cysteine
-
GenBank IDNC_051345 NM_013034.4
-
Entrez GeneSlc6a4 (a.k.a. SERT)
- Promoter CMV
-
Tags
/ Fusion Proteins
- c-myc (N terminal on insert)
- His6 (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGCCAACATGCCAGCATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byB J Hoffman, Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_rSERT_C109A_Y107C was a gift from Gary Rudnick (Addgene plasmid # 190174 ; http://n2t.net/addgene:190174 ; RRID:Addgene_190174) -
For your References section:
Ibogaine, a noncompetitive inhibitor of serotonin transport, acts by stabilizing the cytoplasm-facing state of the transporter. Jacobs MT, Zhang YW, Campbell SD, Rudnick G. J Biol Chem. 2007 Oct 5;282(40):29441-7. doi: 10.1074/jbc.M704456200. Epub 2007 Aug 13. 10.1074/jbc.M704456200 PubMed 17698848