pcDNA3.1_rSERT_X5C_S277C
(Plasmid
#190177)
-
PurposeFor mammalian cell expression of rat SERT and measurement of cytoplasmic pathway accessibility
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7423
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat serotonin transporter
-
Alt namerSERT
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1959
-
MutationCys15Ala, Cys21Ala, Cys109Ala, Ser277Cys, Cys357Ile, Cys622Ala
-
GenBank IDNC_051345 NM_013034.4
-
Entrez GeneSlc6a4 (a.k.a. SERT)
- Promoter CMV
-
Tags
/ Fusion Proteins
- c-myc (N terminal on insert)
- His6 (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGCCAACATGCCAGCATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byB J Hoffman, Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_rSERT_X5C_S277C was a gift from Gary Rudnick (Addgene plasmid # 190177 ; http://n2t.net/addgene:190177 ; RRID:Addgene_190177) -
For your References section:
The cytoplasmic substrate permeation pathway of serotonin transporter. Zhang YW, Rudnick G. J Biol Chem. 2006 Nov 24;281(47):36213-20. doi: 10.1074/jbc.M605468200. Epub 2006 Sep 28. 10.1074/jbc.M605468200 PubMed 17008313