Skip to main content

tdiRFP-BFP reporter
(Plasmid #190184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB510B-1
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    tdiRFP
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer TGGCACCGGCAGCACCGGCAG
  • 3′ sequencing primer GGGGGGGGGGCGGAATTATCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TagBFP2
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site AvrII (unknown if destroyed)
  • 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
  • 3′ sequencing primer GTTTGCTAGGGAGGTCGCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tdiRFP-BFP reporter was a gift from Toshiro Sato (Addgene plasmid # 190184 ; http://n2t.net/addgene:190184 ; RRID:Addgene_190184)
  • For your References section:

    Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028