Skip to main content

pWPT-/mEGFP-1T-IRES-mCherry
(Plasmid #190190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190190 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Plasmid 49235: pWPT-/GCCACC-mEGFP-IRES-mCherry
  • Backbone size w/o insert (bp) 10727
  • Total vector size (bp) 10729
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mEGFP
  • Species
    Synthetic
  • Insert Size (bp)
    738
  • Mutation
    changed EGFP Kozak sequence inserting a C>T modification in position -1 with respect to A of ATG; a CCC Cas9 PAM has been added for base editing of the Kozak sequence.
  • Promoter EIF1-short

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATAAGTGCAGTAGTCGCCGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter EIF1-short

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTCACCTTCAGCTTGGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWPT-/mEGFP-1T-IRES-mCherry was a gift from Alessandro Quattrone (Addgene plasmid # 190190 ; http://n2t.net/addgene:190190 ; RRID:Addgene_190190)
  • For your References section:

    Translational enhancement by base editing of the Kozak sequence rescues haploinsufficiency. Ambrosini C, Destefanis E, Kheir E, Broso F, Alessandrini F, Longhi S, Battisti N, Pesce I, Dassi E, Petris G, Cereseto A, Quattrone A. Nucleic Acids Res. 2022 Oct 14;50(18):10756-10771. doi: 10.1093/nar/gkac799. 10.1093/nar/gkac799 PubMed 36165847