pSBbi-NLSmCherryNLS Clover-HDHB
(Plasmid
#190223)
-
PurposeFluorescent cell cycle reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSBbi-RP
- Backbone size w/o insert (bp) 6625
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman DNA Helicase B (amino acids 994-1087)
-
Alt nameHELB
-
SpeciesH. sapiens (human)
-
MutationAmino Acids 994-1087
-
Entrez GeneHELB (a.k.a. DHB, hDHB)
- Promoter EF1a
-
Tag
/ Fusion Protein
- Clover fluorescent protein (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site x (unknown if destroyed)
- 3′ cloning site x (unknown if destroyed)
- 5′ sequencing primer tcaagcctcagacagtggttc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNLS-mCherry-NLS-P2A-Puromycin
-
Insert Size (bp)1450
- Promoter RPBSA
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site x (unknown if destroyed)
- 3′ cloning site x (unknown if destroyed)
- 5′ sequencing primer x (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.07.24.219907v2.full for BioRxiv preprint.
Addgene NGS results found N208D and E101G mutations in mCherry that do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-NLSmCherryNLS Clover-HDHB was a gift from Laura Heiser (Addgene plasmid # 190223 ; http://n2t.net/addgene:190223 ; RRID:Addgene_190223) -
For your References section:
Analysis and modeling of cancer drug responses using cell cycle phase-specific rate effects. Gross SM, Mohammadi F, Sanchez-Aguila C, Zhan PJ, Liby TA, Dane MA, Meyer AS, Heiser LM. Nat Commun. 2023 Jun 10;14(1):3450. doi: 10.1038/s41467-023-39122-z. 10.1038/s41467-023-39122-z PubMed 37301933