pSBbi-NLSmCherryNLS Clover-HDHB
(Plasmid #190223)

• Purpose: Fluorescent cell cycle reporter
• Depositing Lab: Laura Heiser
• Publication: Gross et al Nat Commun. 2023 Jun 10;14(1):3450. doi: 10.1038/s41467-023-39122-z.

Backbone

• Vector backbone: pSBbi-RP
• Backbone size w/o insert (bp): 6625
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Human DNA Helicase B (amino acids 994-1087)
• Alt name: HELB
• Species: H. sapiens (human)
• Mutation: Amino Acids 994-1087
• Entrez Gene: HELB (a.k.a. DHB, hDHB)
• Promoter: EF1a
• Tag / Fusion Protein:
  • Clover fluorescent protein (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: x (unknown if destroyed)
• 3′ cloning site: x (unknown if destroyed)
• 5′ sequencing primer: tcaagcctcagacagtggttc

Gene/Insert 2

• Gene/Insert name: NLS-mCherry-NLS-P2A-Puromycin
• Insert Size (bp): 1450
• Promoter: RPBSA

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: x (unknown if destroyed)
• 3′ cloning site: x (unknown if destroyed)
• 5′ sequencing primer: x

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.07.24.219907v2.full for BioRxiv preprint.
Addgene NGS results found N208D and E101G mutations in mCherry that do not affect plasmid function.