pTW072
(Plasmid
#190247)
-
PurposeT-DNA for arabidopsis transformation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRANS230d
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA, Cas9, firefly luciferase, bar
-
gRNA/shRNA sequencegRNA1- gttttctcgcacttaagctc and gRNA2- cgacattcataacagagaca
-
Speciesother
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IS4 family transposase (genbank ID:WP_006250222.1) does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTW072 was a gift from Feng Zhang (Addgene plasmid # 190247 ; http://n2t.net/addgene:190247 ; RRID:Addgene_190247) -
For your References section:
Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants. Weiss T, Crisp PA, Rai KM, Song M, Springer NM, Zhang F. Plant Physiol. 2022 Jun 11. pii: 6605859. doi: 10.1093/plphys/kiac285. 10.1093/plphys/kiac285 PubMed 35689624