pPROEX-TwStrp-FTO
(Plasmid
#190265)
-
PurposeExpresses FTO in bacterial cells, with two purification tags: His and Twin-Streptag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPROEX
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 6288
-
Vector typeBacterial Expression
-
Selectable markersn/a
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor plasmid induction of FTO - transform in BL21(DE3), add 2mM IPTG and grow overnight at 16ºC.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFTO
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001080432.3
-
Entrez GeneFTO (a.k.a. ALKBH9, BMIQ14, GDFD, IFEX9)
- Promoter Trc
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- Twin-Streptag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer GCGCTACGGCGTTTCACTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPROEX-TwStrp-FTO was a gift from Samie Jaffrey (Addgene plasmid # 190265 ; http://n2t.net/addgene:190265 ; RRID:Addgene_190265)