pRps9-D95N-IRES-GFP-HygR
(Plasmid
#190272)
-
PurposeExpress RPS9 D95N-mutant mouse gene transcriptionally fused with eGFP. eGFP is translated from IRES.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEBO2
- Total vector size (bp) 8967
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameribosomal protein RPS9
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
MutationD95N
-
GenBank IDNM_029767.2
- Promoter CAGGS-CMV
-
Tag
/ Fusion Protein
- IRES-eGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site BstBI (unknown if destroyed)
- 5′ sequencing primer ATCATTTTGGCAAAGAATTCACC
- 3′ sequencing primer ATTTTCATTACATCTGTGTGTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRps9-D95N-IRES-GFP-HygR was a gift from Erik Böttger (Addgene plasmid # 190272 ; http://n2t.net/addgene:190272 ; RRID:Addgene_190272) -
For your References section:
Error-prone protein synthesis recapitulates early symptoms of Alzheimer disease in aging mice. Brilkova M, Nigri M, Kumar HS, Moore J, Mantovani M, Keller C, Grimm A, Eckert A, Shcherbakov D, Akbergenov R, Seebeck P, Kramer SD, Wolfer DP, Gent TC, Bottger EC. Cell Rep. 2022 Sep 27;40(13):111433. doi: 10.1016/j.celrep.2022.111433. 10.1016/j.celrep.2022.111433 PubMed 36170830