Skip to main content
Addgene

pSPL3-hRPH3A_c.444Gwt
(Plasmid #190476)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190476 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Pspl3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only]
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    384
  • Entrez Gene
    RPH3A
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TCTGAGTCACCTGGACAACC
  • 3′ sequencing primer ATCTCAGTGGTATTTGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPL3-hRPH3A_c.444Gwt was a gift from Alfredo Brusco (Addgene plasmid # 190476 ; http://n2t.net/addgene:190476 ; RRID:Addgene_190476)
  • For your References section:

    Missense variants in RPH3A cause defects in excitatory synaptic function and are associated with a clinically variable neurodevelopmental disorder. Pavinato L, Stanic J, Barzasi M, Gurgone A, Chiantia G, Cipriani V, Eberini I, Palazzolo L, Di Luca M, Costa A, Marcantoni A, Biamino E, Spada M, Hiatt SM, Kelley WV, Vestito L, Sisodiya SM, Efthymiou S, Chand P, Kaiyrzhanov R, Bruselles A, Cardaropoli S, Tartaglia M, De Rubeis S, Buxbaum JD, Smedley D, Ferrero GB, Giustetto M, Gardoni F, Brusco A. Genet Med. 2023 Nov;25(11):100922. doi: 10.1016/j.gim.2023.100922. Epub 2023 Jul 1. 10.1016/j.gim.2023.100922 PubMed 37403762