pSN859
(Plasmid
#190692)
-
PurposeMammalian expression of kinesin scFv(H2) fused with Fc domain of chicken IgY
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneP1316-IgG2a
-
Backbone manufacturerGavin Wright, Sanger; Yves Durocher, NRC
- Backbone size w/o insert (bp) 5925
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namekinesin scFv(H2)::Fc domain of chicken IgY
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttctctccacaggtgtccac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN859 was a gift from Shinsuke Niwa (Addgene plasmid # 190692 ; http://n2t.net/addgene:190692 ; RRID:Addgene_190692) -
For your References section:
Generation of recombinant and chickenized scFv versions of an anti-kinesin monoclonal antibody H2. Niwa S, Chiba K. Cytoskeleton (Hoboken). 2023 Apr 10. doi: 10.1002/cm.21756. 10.1002/cm.21756 PubMed 37036074