pVRC-N-Venus-V150A-apCC-Di
(Plasmid
#190706)
-
PurposeEncodes a modified version (V150A) of N-Venus followed by the antiparallel coiled-coil apCC-Di.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVRC
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameN-Venus-V150A-apCC-Di
-
MutationV150A
- Promoter araBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer atattgcatcagacattgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVRC-N-Venus-V150A-apCC-Di was a gift from Nigel Savery (Addgene plasmid # 190706 ; http://n2t.net/addgene:190706 ; RRID:Addgene_190706) -
For your References section:
De novo designed peptides for cellular delivery and subcellular localisation. Rhys GG, Cross JA, Dawson WM, Thompson HF, Shanmugaratnam S, Savery NJ, Dodding MP, Hocker B, Woolfson DN. Nat Chem Biol. 2022 Jul 14. pii: 10.1038/s41589-022-01076-6. doi: 10.1038/s41589-022-01076-6. 10.1038/s41589-022-01076-6 PubMed 35836017