Skip to main content
Addgene

pCDH-EMTB-TurboID-V5-puro
(Plasmid #190741)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190741 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-Puro
  • Backbone size w/o insert (bp) 7368
  • Total vector size (bp) 9287
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EMTB-TurboID-V5
  • Species
    H. sapiens (human); EMTB is human ensconsin; TurboID is engineered BirA from E.coli
  • Insert Size (bp)
    1914
  • Mutation
    Microtubule binding-domain of ensconsin (amino acids 18-282 of GenBank reference sequence X73882)
  • GenBank ID
  • Entrez Gene
    RPS14 (a.k.a. EMTB, S14, uS11)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer pCDH-Rev (tcggcaattgaacgggtgcctaga)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EMTB-TurboID-V5-puro was a gift from Jeremy Baskin (Addgene plasmid # 190741 ; http://n2t.net/addgene:190741 ; RRID:Addgene_190741)
  • For your References section:

    Proximity Labeling Reveals Spatial Regulation of the Anaphase-Promoting Complex/Cyclosome by a Microtubule Adaptor. Cao X, Shami Shah A, Sanford EJ, Smolka MB, Baskin JM. ACS Chem Biol. 2022 Aug 11. doi: 10.1021/acschembio.2c00527. 10.1021/acschembio.2c00527 PubMed 35952650