pTMK1::TMK1-3FLAG
(Plasmid
#190764)
-
Purposeexpresses a C-terminal 3FLAG TMK1 protein in plant cells from a 2.7 kb TMK1 promoter
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepW1211
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 17000
-
Vector typePlant Expression ; Agrobacterium Binary
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions28C in Agrobacterium tumefaciens
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTMK1 Transmembrane Kinase 1
-
Alt nameAt1g66150
-
SpeciesA. thaliana (mustard weed)
-
GenBank IDNM_105286
-
Entrez GeneTMK1 (a.k.a. AT1G66150, F15E12.4, F15E12_4, transmembrane kinase 1)
- Promoter TMK1 2.7 kb
-
Tag
/ Fusion Protein
- 3FLAG (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGGACAGACATCCCATGTGC
- 3′ sequencing primer CATCGTCCATCTACTGAAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTMK1::TMK1-3FLAG was a gift from Michael Bevan (Addgene plasmid # 190764)