pPhiC31-actIIORF4
(Plasmid
#190785)
-
PurposeThe PhiC31-phage based integration vector containing the actII-ORF4 gene under the control of strong kasOp* promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4065
- Total vector size (bp) 8950
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameT5 terminator
-
Alt nameSLAV_24935 terminator
-
SpeciesStreptomyces lavendulae subsp. lavendulae CCM 3239
-
Insert Size (bp)455
-
GenBank IDCP024985 ATZ26784.1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGAATCCTGCTCTGCGAGGCTGGC
- 3′ sequencing primer catgatcgcgtagtcgatagtgg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameactII-4
-
Alt nameSCO5085
-
SpeciesStreptomyces coelicolor M145
-
Insert Size (bp)768
-
GenBank IDAL645882 SCBAC28G1.11
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer gtgtcgaagtcgacggtgacg
- 3′ sequencing primer catgatcgcgtagtcgatagtgg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namekasOp*
-
Alt namesynthetic kasOp* promoter
-
Speciessynthetic
-
Insert Size (bp)72
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gtgtcgaagtcgacggtgacg
- 3′ sequencing primer catgatcgcgtagtcgatagtgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe actII-4 gene was PCR amplified from Streptomyces coelicolor M145 chromosomal DNA; T5 terminator insert was PCR amplified from Streptomyces lavendulae subsp. lavendulae CCM 3239 chromosomal DNA, kasOp* promoter was cloned as synthetic gene insert
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPhiC31-actIIORF4 was a gift from Jan Kormanec (Addgene plasmid # 190785 ; http://n2t.net/addgene:190785 ; RRID:Addgene_190785) -
For your References section:
A stable vector for efficient production of heterologous proteins and secondary metabolites in streptomycetes. Novakova R, Homerova D, Csolleiova D, Rezuchova B, Sevcikova B, Javorova R, Feckova L, Kormanec J. Appl Microbiol Biotechnol. 2022 Nov;106(21):7285-7299. doi: 10.1007/s00253-022-12187-4. Epub 2022 Sep 29. 10.1007/s00253-022-12187-4 PubMed 36173451