pCosSAD1AprR
(Plasmid
#190786)
-
PurposeAn E. coli cloning vector for the integration of heterologous genes into a linear plasmid pSA3239 in Streptomyces lavendulae subsp. lavendulae CCM 3239 through homologous recombination
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesCos-1
- Backbone size w/o insert (bp) 7907
- Total vector size (bp) 23985
-
Vector typeBacterial Expression
-
Selectable markersapramycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameupstream region of the aur1 cluster for auricin
-
SpeciespSA3239
-
Insert Size (bp)5719
-
GenBank IDKJ396772
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Sau3AI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ccgaaaagtgccacctgacg
- 3′ sequencing primer GGAATCCTGCTCTGCGAGGCTGGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameampramycin resistance cassette
-
Alt nameaac(3)IV
-
SpeciespIJ773
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer cggcgtgagcgactctccatcc
- 3′ sequencing primer tcgggatgctcacgaaaagcc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namedownstream region of the aur1 cluster for auricin
-
SpeciespSA3239
-
GenBank IDKJ396772
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site Sau3AI (not destroyed)
- 5′ sequencing primer CGATGCCGCTCGCCAGTCGATTGG
- 3′ sequencing primer cagagcttatcgatgataagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byApramycin resistance resistance cassette was PCR amplified from pIJ773
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCosSAD1AprR was a gift from Jan Kormanec (Addgene plasmid # 190786 ; http://n2t.net/addgene:190786 ; RRID:Addgene_190786) -
For your References section:
A stable vector for efficient production of heterologous proteins and secondary metabolites in streptomycetes. Novakova R, Homerova D, Csolleiova D, Rezuchova B, Sevcikova B, Javorova R, Feckova L, Kormanec J. Appl Microbiol Biotechnol. 2022 Nov;106(21):7285-7299. doi: 10.1007/s00253-022-12187-4. Epub 2022 Sep 29. 10.1007/s00253-022-12187-4 PubMed 36173451