Skip to main content

pTSK405
(Plasmid #190817)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190817 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTSK241
  • Backbone size w/o insert (bp) 7637
  • Total vector size (bp) 8950
  • Vector type
    Bacterial cloning vector
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    URA3
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1307
  • Entrez Gene
    URA3 (a.k.a. YEL021W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer caagcggccgccgctgctgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSK405 was a gift from Tatiana Karpova & Gunjan Mehta (Addgene plasmid # 190817 ; http://n2t.net/addgene:190817 ; RRID:Addgene_190817)
  • For your References section:

    Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin. Ball DA, Mehta GD, Salomon-Kent R, Mazza D, Morisaki T, Mueller F, McNally JG, Karpova TS. Nucleic Acids Res. 2016 Dec 1;44(21):e160. doi: 10.1093/nar/gkw744. Epub 2016 Aug 26. 10.1093/nar/gkw744 PubMed 27566148