pLIB_BSSHI_6xHisTEV-WIPI2d
(Plasmid
#190863)
-
PurposePlasmid for the expression of purification of WIPI2d: SMC Internal reference: SMC1216
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190863 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIB
-
Backbone manufacturerJan-Michael Peters
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 6242
-
Vector typeBacterial Expression, Insect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWIPI2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1278
-
MutationSNP C to G at position 4562 (Val)
-
GenBank IDNC_000007.14
-
Entrez GeneWIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BssHII (not destroyed)
- 3′ cloning site HindII (not destroyed)
- 5′ sequencing primer TCCCTGAAAATACAGGTTTTC
- 3′ sequencing primer ACAAACCACAACTAGAATGCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIB_BSSHI_6xHisTEV-WIPI2d was a gift from Sascha Martens (Addgene plasmid # 190863 ; http://n2t.net/addgene:190863 ; RRID:Addgene_190863)