pTSK573
(Plasmid
#190881)
-
PurposeFor C-terminal -Halo Tagging of a gene of interest with TRP1 selection marker in yeast S. cerevisiae
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190881 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTSK568
- Backbone size w/o insert (bp) 6958
- Total vector size (bp) 7897
-
Vector typeBacterial cloning vector
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag
-
SpeciesBacteria Rhodococcus rhodochrous
-
Insert Size (bp)939
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer cgatccgcttgagcaaagcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSK573 was a gift from Tatiana Karpova & Gunjan Mehta (Addgene plasmid # 190881 ; http://n2t.net/addgene:190881 ; RRID:Addgene_190881) -
For your References section:
Single-molecule tracking for studying protein dynamics and target-search mechanism in live cells of S. cerevisiae. Podh NK, Das A, Dey P, Paliwal S, Mehta G. STAR Protoc. 2022 Dec 16;3(4):101900. doi: 10.1016/j.xpro.2022.101900. Epub 2022 Dec 5. 10.1016/j.xpro.2022.101900 PubMed 36595957