Skip to main content
Addgene

pUC18_BCR_GUSB_e6a2
(Plasmid #190882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18
  • Backbone manufacturer
    University of California
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 6034
  • Vector type
    cloned cDNA transcripts for use in RT-qPCR BCR::ABL1 monitoring of atypical transcripts

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    e6a2 cDNA
  • Insert Size (bp)
    1478

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CAAAGATGCCAAGGATCCAACGACCAAG
  • 3′ sequencing primer CTT CGT TCT GAG ATA CTG GAT TCC T
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GUSB cDNA transcript
  • Insert Size (bp)
    813
  • GenBank ID
    NM_000181.4
  • Entrez Gene
    GUSB (a.k.a. BG, MPS7)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer tttccgtaccagccactacc
  • 3′ sequencing primer gtaaacgggctgttttccaa
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    BCR cDNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    963
  • GenBank ID
    Y00661
  • Entrez Gene
    BCR (a.k.a. ALL, BCR1, CML, D22S11, D22S662, PHL)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GTCCACTCAGCCACTGGATT
  • 3′ sequencing primer CAAGGACCAGCTGTCAGTCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid can be linearised using HindIII

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC18_BCR_GUSB_e6a2 was a gift from Nicholas Cross (Addgene plasmid # 190882 ; http://n2t.net/addgene:190882 ; RRID:Addgene_190882)
  • For your References section:

    Assessment of individual molecular response in chronic myeloid leukemia patients with atypical BCR-ABL1 fusion transcripts: recommendations by the EUTOS cooperative network. Schafer V, White HE, Gerrard G, Mobius S, Saussele S, Franke GN, Mahon FX, Talmaci R, Colomer D, Soverini S, Machova Polakova K, Cross NCP, Hochhaus A, Ernst T. J Cancer Res Clin Oncol. 2021 Oct;147(10):3081-3089. doi: 10.1007/s00432-021-03569-8. Epub 2021 Mar 7. 10.1007/s00432-021-03569-8 PubMed 33677711