pUC18_BCR_GUSB_e19a2
(Plasmid
#190884)
-
Purposemolecular monitoring of atypical BCR::ABL1 fusion transcripts
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Backbone manufacturerUniversity of California
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 6202
-
Vector typecloned cDNA transcripts for use in RT-qPCR BCR::ABL1 monitoring of atypical transcripts
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namee19a2 BCR::ABL1 fusion cDNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1646
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGAGGAGGTGGGCATCTACCG
- 3′ sequencing primer CTTCGTTCTGAGATACTGGATTCCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGUSB cDNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)813
-
GenBank IDNM_000181.4
-
Entrez GeneGUSB (a.k.a. BG, MPS7)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer tttccgtaccagccactacc
- 3′ sequencing primer gtaaacgggctgttttccaa
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameBCR cDNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)963
-
GenBank IDY00661
-
Entrez GeneBCR (a.k.a. ALL, BCR1, CML, D22S11, D22S662, PHL)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GTCCACTCAGCCACTGGATT
- 3′ sequencing primer CAAGGACCAGCTGTCAGTCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid can be linearised using HindIII
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC18_BCR_GUSB_e19a2 was a gift from Nicholas Cross (Addgene plasmid # 190884 ; http://n2t.net/addgene:190884 ; RRID:Addgene_190884) -
For your References section:
Assessment of individual molecular response in chronic myeloid leukemia patients with atypical BCR-ABL1 fusion transcripts: recommendations by the EUTOS cooperative network. Schafer V, White HE, Gerrard G, Mobius S, Saussele S, Franke GN, Mahon FX, Talmaci R, Colomer D, Soverini S, Machova Polakova K, Cross NCP, Hochhaus A, Ernst T. J Cancer Res Clin Oncol. 2021 Oct;147(10):3081-3089. doi: 10.1007/s00432-021-03569-8. Epub 2021 Mar 7. 10.1007/s00432-021-03569-8 PubMed 33677711