pPN-mKate (PT7LacO-PN-mKate)
(Plasmid
#191126)
-
PurposeExpression of protein N tagged with mKate from a T7-lac inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-LacO
- Backbone size w/o insert (bp) 4145
- Total vector size (bp) 4466
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProtein N
-
Alt nameλN
-
Alt namePN
-
SpeciesSynthetic
-
Insert Size (bp)321
- Promoter T7-lac inducible promoter
-
Tag
/ Fusion Protein
- mKate
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atggtgtccgggatctcgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPN-mKate (PT7LacO-PN-mKate) was a gift from Ariel Lindner (Addgene plasmid # 191126 ; http://n2t.net/addgene:191126 ; RRID:Addgene_191126) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672