pVioCD53
(Plasmid
#191130)
-
PurposeExpression of vioC, truncated vioD and tdMCP form a J23105 constitutive promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1A3-J23105
- Backbone size w/o insert (bp) 2301
- Total vector size (bp) 4886
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsuse BL21A1 for protein expression
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namevioC
-
SpeciesSynthetic
-
Insert Size (bp)1284
-
Entrez GenevioC (a.k.a. CV_3272)
- Promoter J23105 constitutive promoter
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer tgccacctgacgtctaagaa
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namevioD truncated
-
Alt namevioD
-
SpeciesSynthetic
-
Insert Size (bp)790
-
MutationC-terminal truncation from 264th amino acid
Gene/Insert 3
-
Gene/Insert namedMCP off-frame
-
Alt nameMCP
-
Alt namedMCP
-
SpeciesSynthetic
-
Insert Size (bp)291
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVioCD53 was a gift from Ariel Lindner (Addgene plasmid # 191130 ; http://n2t.net/addgene:191130 ; RRID:Addgene_191130) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672