pCMV-HA-mCherry
(Plasmid
#191136)
-
Purposeexpresses mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-HA
- Backbone size w/o insert (bp) 3773
- Total vector size (bp) 4486
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
Alt namemCherry
-
Insert Size (bp)711
-
GenBank ID
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer ACAGAATTCGGATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer ACAAGATCTCTACTTGTACAGCTCGTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-mCherry was a gift from Ken-ichirou Morohashi (Addgene plasmid # 191136 ; http://n2t.net/addgene:191136 ; RRID:Addgene_191136) -
For your References section:
Tmsb10 triggers fetal Leydig differentiation by suppressing the RAS/ERK pathway. Inoue M, Baba T, Takahashi F, Terao M, Yanai S, Shima Y, Saito D, Sugihara K, Miura T, Takada S, Suyama M, Ohkawa Y, Morohashi KI. Commun Biol. 2022 Sep 15;5(1):974. doi: 10.1038/s42003-022-03941-5. 10.1038/s42003-022-03941-5 PubMed 36109592