pCALNL-tdTomato-2A-mSyp::EGFP
(Plasmid
#191213)
-
PurposeExpresses tdTomato protein and mouse Synaptophysin protein fused with EGFP in Cre expressing mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCALNL
-
Backbone manufacturerConnie Cepko (Addgene plasmid # 13769)
- Backbone size w/o insert (bp) 6107
- Total vector size (bp) 9288
-
Vector typeMammalian Expression ; pCAGEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato-T2A-mSyp::EGFP
-
Alt nametdTomato
-
Alt namemouse Synaptophysin
-
Alt nameenhanced green fluorescent protein
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3181
-
GenBank IDNM_009305.2
-
Entrez GeneSyp (a.k.a. A230093K24Rik, Syn, p38)
-
Tag
/ Fusion Protein
- mSyp::EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aaggcctgtccgatgtgaag
- 3′ sequencing primer ttcaggaagccaaacaccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Suggested primers to sequence the insert:
5' ccttcttgacgagttcttctg 3'
5' acgtctccgcatgtcagaag 3'
5' aaggcctgtccgatgtgaag 3'
5' ttcaggaagccaaacaccac 3'
5' GCTTGCCGTAGGTGGCATC 3'
5' CAGGAAACAGCTATGAC 3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCALNL-tdTomato-2A-mSyp::EGFP was a gift from Theofanis Karayannis (Addgene plasmid # 191213 ; http://n2t.net/addgene:191213 ; RRID:Addgene_191213) -
For your References section:
Sparse postnatal labeling and quantification of superficial cortical cell synapses in the mouse neocortex. Gesuita L, Argunsah AO, Karayannis T. STAR Protoc. 2022 Nov 11;3(4):101837. doi: 10.1016/j.xpro.2022.101837. eCollection 2022 Dec 16. 10.1016/j.xpro.2022.101837 PubMed 36386881