P74-26 Tail Tube Protein (gp93) in pSMT3
(Plasmid
#191261)
-
PurposeExpresses P74-26 gp93 with a His-SUMO tag in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSMT3
- Backbone size w/o insert (bp) 5599
- Total vector size (bp) 6646
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe recommend expressing the plasmid in ArcticExpress (DE3) cells.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameP74-26 gp93
-
Alt nameP74-26 Tail Tube Protein
-
Alt nameP74-26 TTP
-
SpeciesThermus Virus P74-26
-
Insert Size (bp)1044
-
GenBank IDEU100884.1
- Promoter T7
-
Tag
/ Fusion Protein
- His-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GATCGGATCCATGCGTGGTGTGGACACC
- 3′ sequencing primer GATCCTCGAGTTAGAATTTCGCAACGTGGGTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P74-26 Tail Tube Protein (gp93) in pSMT3 was a gift from Brian Kelch (Addgene plasmid # 191261 ; http://n2t.net/addgene:191261 ; RRID:Addgene_191261) -
For your References section:
Conformational dynamics control assembly of an extremely long bacteriophage tail tube. Agnello E, Pajak J, Liu X, Kelch BA. J Biol Chem. 2023 Feb 13:103021. doi: 10.1016/j.jbc.2023.103021. 10.1016/j.jbc.2023.103021 PubMed 36791911