pTETDuet_F31YG121VDHFR_R166QTS
(Plasmid
#191299)
-
PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTET-duet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namefolA, thyA
-
Alt nameDHFR
-
Alt nameTS
-
SpeciesE. coli
-
MutationF31Y/G121V DHFR, R166Q TYMS
- Promoter T7 (folA), Tet (thyA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoNI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer _GGATCTCGACGCTCTCCCTT
- 3′ sequencing primer _CCGCTGAGCAATAACTAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTETDuet_F31YG121VDHFR_R166QTS was a gift from Kimberly Reynolds (Addgene plasmid # 191299 ; http://n2t.net/addgene:191299 ; RRID:Addgene_191299) -
For your References section:
The genetic landscape of a metabolic interaction. Nguyen TN, Ingle C, Thompson S, Reynolds KA. Nat Commun. 2024 Apr 18;15(1):3351. doi: 10.1038/s41467-024-47671-0. 10.1038/s41467-024-47671-0 PubMed 38637543