pIRES2_hMela(CT+IL3 mGluR6)
(Plasmid
#191343)
-
PurposeOptogenetic tool
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIRES2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5277
- Total vector size (bp) 6666
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehMela(CT+IL3 mGluR6)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDMQ072299.1
-
Tag
/ Fusion Protein
- IRES_Turbo
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgaaccctccttcggggccaag
- 3′ sequencing primer cCCAGCACCTGCCCTGCCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES2_hMela(CT+IL3 mGluR6) was a gift from Sonja Kleinlogel (Addgene plasmid # 191343 ; http://n2t.net/addgene:191343 ; RRID:Addgene_191343) -
For your References section:
Bipolar cell targeted optogenetic gene therapy restores parallel retinal signaling and high-level vision in the degenerated retina. Kralik J, van Wyk M, Stocker N, Kleinlogel S. Commun Biol. 2022 Oct 20;5(1):1116. doi: 10.1038/s42003-022-04016-1. 10.1038/s42003-022-04016-1 PubMed 36266533