Skip to main content

pQnl_tet
(Plasmid #191355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQmod2E-GG (Addgene 191345)
  • Backbone manufacturer
    Tolonen Lab
  • Backbone size w/o insert (bp) 5471
  • Modifications to backbone
    Inserted PGusA2-TetO2/1-Nanoluc, miniPthl-tetR cassette
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PGusA2-TetO2/1-Nanoluc, miniPthl-tetR cassette
  • Species
    Synthetic
  • Insert Size (bp)
    1383
  • Promoter PGus2A-TetO2/1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CAGGAAACAGCTATGACCGC
  • 3′ sequencing primer GCTAAGGATTCAGAACGGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Promega

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQnl_tet was a gift from Andrew Tolonen (Addgene plasmid # 191355 ; http://n2t.net/addgene:191355 ; RRID:Addgene_191355)
  • For your References section:

    Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328