pQdC12a
(Plasmid #191356)

• Purpose: Clostridium CRISPRi plasmid with TetR-repressible dCas12a (LbCpf1) expression
• Depositing Lab: Andrew Tolonen
• Publication: Rostain et al ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25.

Backbone

• Vector backbone: pQmod3C-GG
• Backbone manufacturer: Tolonen Lab
• Backbone size w/o insert (bp): 4581
• Total vector size (bp): 8290
• Modifications to backbone: PGusA2-TetO2/1 driving expression of dCas12a, miniPthl driving expression of tetR, gRNA cassette for dCas12a
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PGusA2-TetO2/1-dCas12a (LbCpf1)
• Species: Synthetic
• Insert Size (bp): 3791
• Promoter: PGus2A-TetO2/1

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: caggaaacagctatgaccgc
• 3′ sequencing primer: cactgttatgccttttgact

Gene/Insert 2

• Gene/Insert name: miniPthl-tetR
• Insert Size (bp): 728
• Promoter: miniPthl

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: acaaggagtggctggagtac
• 3′ sequencing primer: ggaagattcgatcgctatgct

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cas12a (LbCpf1) cloned from Addgene 84740

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Clostridium CRISPRi plasmid with TetR-repressible dCas12a (LbCpf1) expression