Skip to main content

eSpCas9(1.1)_NoFlag_hROSA26_Left
(Plasmid #191442)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191442 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    eSpCas9(1.1)_No_FLAG (Plasmid #79877)
  • Backbone size w/o insert (bp) 8437
  • Total vector size (bp) 8439
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hROSA26 sgRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

-hROSA26 guide sequence (aka gRNA- L) is GTCGAGTCGCTTCTCGATTA see PMID: 27899508

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)_NoFlag_hROSA26_Left was a gift from Yannick Doyon (Addgene plasmid # 191442 ; http://n2t.net/addgene:191442 ; RRID:Addgene_191442)