Skip to main content

hTln1-R12DD-SCLS
(Plasmid #191443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191443 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5658
  • Total vector size (bp) 6912
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Talin1 R12DD
  • Alt name
    hTln1-R12DD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1254
  • Mutation
    deletion between residues K2375 and A2397
  • GenBank ID
    NC_000009.12
  • Entrez Gene
    TLN1 (a.k.a. ILWEQ, TLN, talin-1)
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.10.17.22280833 for medRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hTln1-R12DD-SCLS was a gift from Ben Goult (Addgene plasmid # 191443 ; http://n2t.net/addgene:191443 ; RRID:Addgene_191443)
  • For your References section:

    Talin1 dysfunction is genetically linked to systemic capillary leak syndrome. Elefant N, Rouni G, Arapatzi C, Oz-Levi D, Sion-Sarid R, Edwards WJ, Ball NJ, Yanovsky-Dagan S, Cowell AR, Meiner V, Vainstein V, Grammenoudi S, Lancet D, Goult BT, Harel T, Kostourou V. JCI Insight. 2024 Dec 20;9(24):e173664. doi: 10.1172/jci.insight.173664. 10.1172/jci.insight.173664 PubMed 39704176