pB7N_LT51-Mt-tk_v8_AGKS
(Plasmid
#191515)
-
PurposeExpression of mitochondrial v8 ZF-DdCBE in mammalian cells (N-terminal DddAC, Left)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB7N
- Total vector size (bp) 6042
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namev8 ZF-DdCBE LT51-Mt-tk AGKS
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggtgatgcggttttggcagtacatcaat
- 3′ sequencing primer tgaataatcaaacaaaaattatccaggacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB7N_LT51-Mt-tk_v8_AGKS was a gift from David Liu (Addgene plasmid # 191515 ; http://n2t.net/addgene:191515 ; RRID:Addgene_191515) -
For your References section:
Compact zinc finger base editors that edit mitochondrial or nuclear DNA in vitro and in vivo. Willis JCW, Silva-Pinheiro P, Widdup L, Minczuk M, Liu DR. Nat Commun. 2022 Nov 23;13(1):7204. doi: 10.1038/s41467-022-34784-7. 10.1038/s41467-022-34784-7 PubMed 36418298