pJH4143
(Plasmid
#191531)
-
PurposePunc-17-Cre unc-54 3'UTR C.elegans for Cre/Lox
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 6679
- Total vector size (bp) 7737
-
Vector typeCre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1058
- Promoter Punc-17
-
Tag
/ Fusion Protein
- no taq
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aCCATGGgcgcacccaagaagaagag
- 3′ sequencing primer gactaatcgccatcttccagcagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH4143 was a gift from Mei Zhen (Addgene plasmid # 191531 ; http://n2t.net/addgene:191531 ; RRID:Addgene_191531) -
For your References section:
Extrasynaptic signaling enables an asymmetric juvenile motor circuit to produce symmetric undulation. Lu Y, Ahamed T, Mulcahy B, Meng J, Witvliet D, Guan SA, Holmyard D, Hung W, Wen Q, Chisholm AD, Samuel ADT, Zhen M. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. Epub 2022 Sep 30. 10.1016/j.cub.2022.09.002 PubMed 36182701