Skip to main content

pJH4253
(Plasmid #191539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191539 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 10497
  • Total vector size (bp) 11708
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chrimson
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1211
  • Promoter Prig-3
  • Tag / Fusion Protein
    • wCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gctagcATGGCTGAGCTCATCTCC
  • 3′ sequencing primer GGTACCGCGACGGTGTCCTCGTCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH4253 was a gift from Mei Zhen (Addgene plasmid # 191539 ; http://n2t.net/addgene:191539 ; RRID:Addgene_191539)
  • For your References section:

    Extrasynaptic signaling enables an asymmetric juvenile motor circuit to produce symmetric undulation. Lu Y, Ahamed T, Mulcahy B, Meng J, Witvliet D, Guan SA, Holmyard D, Hung W, Wen Q, Chisholm AD, Samuel ADT, Zhen M. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. Epub 2022 Sep 30. 10.1016/j.cub.2022.09.002 PubMed 36182701