Skip to main content

LentiCRISPR v2 sgZER1-1
(Plasmid #191549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXPR_023 LentiCRISPR v2
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9
  • Alt name
    sgRNA ZER1
  • gRNA/shRNA sequence
    CAGGGACCCAATCAATCATG
  • Species
    H. sapiens (human); Other
  • Entrez Gene
    ZER1 (a.k.a. C9orf60, Hzyg, RP11-545E17.4, ZYG, ZYG11BL)

Cloning Information

  • Cloning method Ligation Independent Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR v2 sgZER1-1 was a gift from Elizabeth White (Addgene plasmid # 191549 ; http://n2t.net/addgene:191549 ; RRID:Addgene_191549)
  • For your References section:

    ZER1 Contributes to the Carcinogenic Activity of High-Risk HPV E7 Proteins. Nouel J, White EA. mBio. 2022 Nov 8:e0203322. doi: 10.1128/mbio.02033-22. 10.1128/mbio.02033-22 PubMed 36346242