LentiCRISPR v2 sgZER1-2
(Plasmid
#191550)
-
PurposeExpression of spCas9 and sgRNA targetting ZER1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXPR_023 LentiCRISPR v2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
Alt namesgRNA ZER1
-
gRNA/shRNA sequenceAGGCTGAAGAAGCTCTCGTG
-
SpeciesH. sapiens (human); Other
-
Entrez GeneZER1 (a.k.a. C9orf60, Hzyg, RP11-545E17.4, ZYG, ZYG11BL)
Cloning Information
- Cloning method Ligation Independent Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.18.500567v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR v2 sgZER1-2 was a gift from Elizabeth White (Addgene plasmid # 191550 ; http://n2t.net/addgene:191550 ; RRID:Addgene_191550) -
For your References section:
ZER1 Contributes to the Carcinogenic Activity of High-Risk HPV E7 Proteins. Nouel J, White EA. mBio. 2022 Nov 8:e0203322. doi: 10.1128/mbio.02033-22. 10.1128/mbio.02033-22 PubMed 36346242