pLenti-Sa-gRNA-puro
(Plasmid
#191652)
-
PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-gRNA-puro (Addgene #180426)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS. aureus gRNAscr
-
Alt nameUniversal mammalian negative control (scrambled) gRNA for S. aureus
-
gRNA/shRNA sequenceGCACTACCAGAGCTAACTCA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)467
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Sa-gRNA-puro was a gift from Moshe Szyf (Addgene plasmid # 191652 ; http://n2t.net/addgene:191652 ; RRID:Addgene_191652) -
For your References section:
The PROTECTOR strategy employs dCas orthologs to sterically shield off-target sites from CRISPR/Cas activity. Sapozhnikov DM, Szyf M. Sci Rep. 2023 Feb 9;13(1):2280. doi: 10.1038/s41598-023-29332-2. 10.1038/s41598-023-29332-2 PubMed 36759683