pCRISPomyces-AsCas12j-2
(Plasmid #191655)

• Purpose: All-in-one editing CRISPR-Cas construct for one-step genome editing of Streptomyces using AsCas12j-2
• Depositing Lab: Fong Tian Wong
• Publication: Tan et al Biomolecules. 2024 Apr 16;14(4):486. doi: 10.3390/biom14040486.

Backbone

• Vector backbone: pCRISPomyces-2
• Backbone size w/o insert (bp): 6888
• Total vector size (bp): 9159
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AsCas12j-2
• Alt name: CasΦ-2
• Alt name: Cas12j2
• Species: Acidaminococcus sp.
• Insert Size (bp): 2274
• Promoter: rpsL(XC)-BbsI

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccgtgagctcgagtagacgacggagacgtaatgccc
• 3′ sequencing primer: ttttgcggggaacgcgtagatctgaattctcagctggtc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.10.28.465406 for bioRxiv preprint.