pcDNA3.1-Hyg-mEGFP-pp4640
(Plasmid #191846)

• Purpose: Expresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusion
• Depositing Lab: Bertrand Collet
• Publication: Teige et al Front Immunol. 2019 Sep 6;10:2119. doi: 10.3389/fimmu.2019.02119. eCollection 2019.

Backbone

• Vector backbone: pcDNA3.1-(-)-Hyg
• Backbone manufacturer: Thermofisher scientific
• Backbone size w/o insert (bp): 5596
• Total vector size (bp): 11165
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mEGFP-pp4640
• Species: Synthetic; Salmon alphavirus
• Insert Size (bp): 3945
• Mutation: mEGFP fusion in Nterminal, some silent point mutation to remove restriction sites
• Promoter: CMV
• Tag / Fusion Protein:
  • mEGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: pcDNA3_for: GGCTAACTAGAGAACCCACTG
• 3′ sequencing primer: pcDNA3_rev: GGCAACTAGAAGGCACAGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry