pCRISPR3_BC2
              
              
                (Plasmid
                
                #191857)
              
            
            
            
          - 
            Purpose(Empty Backbone) Barcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCRISPR3
- Backbone size (bp) 2354
- 
              Vector typeCRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer CTTCACCTCGAGAGGTTTGACAG
- 3′ sequencing primer CCATTATTAGTACAGCGAGGCAAC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.08.19.504444v1 bioRxiv preprint.
This E. coli plasmid is an empty vector used to express CRISPRi sgRNAs and constitutively expresses a selectable KanR gene. It contains a 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region. This can be used to sequence an sgRNA array and the plasmid barcode in a single NGS read, thus assigning a paired sgRNA identity and plasmid backbone identity.
This internal barcoding strategy enables a single, mixed CRISPRi experiment to contain biological replicates, identified using distinct plasmid barcodes. It also contains orthogonal priming sites specific to the pCRISPR3 plasmid backbone, which can be used to specifically amplify pCRISPR3 plasmids from a mixed plasmid pool (generated during the cloning methods described in the publications below).
See the following publications for details and cloning information:
Mathis et al., A simplified strategy for titrating gene expression reveals new relationships between genotype, environment, and bacterial growth. https://pubmed.ncbi.nlm.nih.gov/33221881/
Otto et al., A continuous epistasis model for predicting growth rate given combinatorial variation in gene expression and environment.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCRISPR3_BC2 was a gift from Kimberly Reynolds (Addgene plasmid # 191857 ; http://n2t.net/addgene:191857 ; RRID:Addgene_191857)
- 
                For your References section: A continuous epistasis model for predicting growth rate given combinatorial variation in gene expression and environment. Otto RM, Turska-Nowak A, Brown PM, Reynolds KA. Cell Syst. 2024 Feb 21;15(2):134-148.e7. doi: 10.1016/j.cels.2024.01.003. Epub 2024 Feb 9. 10.1016/j.cels.2024.01.003 PubMed 38340730
