pHR-Hsp-eGFP-PGK-mCherry
(Plasmid
#191862)
-
PurposeHeat inducible eGFP reporter with constitutive mCherry marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
- Promoter HSPA7 promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gggtacagtgcaggggaaagaa
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Insert Size (bp)709
- Promoter PGK promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gggtaggggaggcgcttttc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-Hsp-eGFP-PGK-mCherry was a gift from Yingxiao Wang (Addgene plasmid # 191862 ; http://n2t.net/addgene:191862 ; RRID:Addgene_191862) -
For your References section:
Control of the activity of CAR-T cells within tumours via focused ultrasound. Wu Y, Liu Y, Huang Z, Wang X, Jin Z, Li J, Limsakul P, Zhu L, Allen M, Pan Y, Bussell R, Jacobson A, Liu T, Chien S, Wang Y. Nat Biomed Eng. 2021 Nov;5(11):1336-1347. doi: 10.1038/s41551-021-00779-w. Epub 2021 Aug 12. 10.1038/s41551-021-00779-w PubMed 34385696