pET28 mid.3
(Plasmid
#191884)
-
PurposeEncodes a GFP design, mid.3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28
- Backbone size w/o insert (bp) 5209
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemid.3
-
SpeciesAequorea victoria
-
Insert Size (bp)747
-
MutationS72A T108V Y145M T167V H181I V224I
- Promoter T7
-
Tag
/ Fusion Protein
- His Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Design created by the htFuncLib algorithm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28 mid.3 was a gift from Sarel Fleishman (Addgene plasmid # 191884 ; http://n2t.net/addgene:191884 ; RRID:Addgene_191884) -
For your References section:
Designed active-site library reveals thousands of functional GFP variants. Weinstein JY, Marti-Gomez C, Lipsh-Sokolik R, Hoch SY, Liebermann D, Nevo R, Weissman H, Petrovich-Kopitman E, Margulies D, Ivankov D, McCandlish DM, Fleishman SJ. Nat Commun. 2023 May 20;14(1):2890. doi: 10.1038/s41467-023-38099-z. 10.1038/s41467-023-38099-z PubMed 37210560