Skip to main content
Addgene

pET28 sf:bleach.1
(Plasmid #191929)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191929 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28
  • Backbone size w/o insert (bp) 5209
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sf:bleach.1
  • Species
    Aequorea victoria
  • Insert Size (bp)
    747
  • Mutation
    T108L Y145M T167V L220V
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Design created by the htFuncLib algorithm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28 sf:bleach.1 was a gift from Sarel Fleishman (Addgene plasmid # 191929 ; http://n2t.net/addgene:191929 ; RRID:Addgene_191929)
  • For your References section:

    Designed active-site library reveals thousands of functional GFP variants. Weinstein JY, Marti-Gomez C, Lipsh-Sokolik R, Hoch SY, Liebermann D, Nevo R, Weissman H, Petrovich-Kopitman E, Margulies D, Ivankov D, McCandlish DM, Fleishman SJ. Nat Commun. 2023 May 20;14(1):2890. doi: 10.1038/s41467-023-38099-z. 10.1038/s41467-023-38099-z PubMed 37210560